Taxonomic identification report
Sample ID: Bac2_16S
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:10 |
| Analysis completed | 2025-05-03 01:28:10 |
| Wall time | 0:0:0 hours |
Result overview
Inconclusive
Outcome: The analyst should attempt subjective species identification at the genus level.
Reasoning: [Flag 1C] >3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1C) Bacteria. |
Database coverage of Preliminary Morphology ID Bacteria
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis.
No taxa of interest provided at rank genus/species
Sample details
| Locus | 16S rRNA |
| Preliminary ID | Bacteria |
| Taxa of interest | |
| Country | Australia |
| Host | potato (Solanum tuberosum) |
| Sample ID | Bac2_16S |
| Query DNA sequence |
Input DNA sequence
>Bac2_16S ATTACTAGCGATTCCGACTTCATGGAGTCGAGTTGCAGACTCCAATCCGGACTACGACGT ACTTTATGAGGTCCGCTTGCTCTCGCGAGGTCGCTTCTCTTTGTATACGCCATTGTAGCA CGTGTGTAGCCCTACTCGTAAGGGCCATGATGACTTGACGTCATCCCCACCTTCCTCCGG TTTATCACCGGCAGTCTCCTTTGAGTTCCCGACCGAATCGCTGGCAACAAAGGATAAGGG TTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCA GCACCTGTCTCASAGTTCCCGAAGGCACCAAAGYATCTCTGCTAAGTTCTSTGGATGTCA AGAGTAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCG GGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGATTT AACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAATCGACATCGTTTAC AGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTC AGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCA CCGCTACACCTGGAATTCTACCCCCCTCTACAAGACTCTAGCCTGTCAGTTTTGAATGCA GTTCCCAGGTTAAGCCCGGGGATTTCACATCCAACTTAACAGACCGCCTGCGTGCGCTTT ACGCCCAGTCATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGA GTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATCGATAAGGTTATTAACCTTACCGCCT TCCTCCCCGCTGAAAGTGCTTTACAACCCGAAGGCCTTCTTCACACACGCGGCATGGCTG CATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGAC CGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAG GTGAGCCATTACCTCACCTACTAGCTAATCCCATCTGGGCACATCTGATGGCGAGAGGCC CGAAGGTCCCCCTCTTTGCTCTTGCGAGGTTATGCGGTATTAGCTACCGTTTCCAGTAGT TATCCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCGCTCGTCACCCA AAGAGCAAGCTCTTCTGTGCTACCGCTCGACTTGCATGTGTTAGGCCTGCCG
Analyst evaluation
Identification of candidate species
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 500 | 20 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
Candidate species
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Pectobacterium brasiliense | 230 | 99.8% | 0.0 |
Database coverage of Candidate Pectobacterium brasilienseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium sp. | 16 | 99.8% | 0.0 |
Database coverage of Candidate Pectobacterium sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium versatile | 38 | 99.8% | 0.0 |
Database coverage of Candidate Pectobacterium versatileThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium aroidearum | 3 | 99.8% | 0.0 |
Database coverage of Candidate Pectobacterium aroidearumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| uncultured Erwinia sp. | 2 | 99.7% | 0.0 |
Database coverage of Candidate uncultured Erwinia sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| uncultured bacterium | 5 | 99.7% | 0.0 |
Database coverage of Candidate uncultured bacteriumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium carotovorum | 165 | 99.7% | 0.0 |
Database coverage of Candidate Pectobacterium carotovorumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| bacterium | 8 | 99.7% | 0.0 |
Database coverage of Candidate bacteriumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium sp. 21LCBS03 | 1 | 99.4% | 0.0 |
Database coverage of Candidate Pectobacterium sp. 21LCBS03This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium sp. CW5 | 1 | 99.2% | 0.0 |
Database coverage of Candidate Pectobacterium sp. CW5This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium sp. W2Apr18 | 1 | 99.2% | 0.0 |
Database coverage of Candidate Pectobacterium sp. W2Apr18This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Erwinia sp. HY001006-1 | 1 | 99.2% | 0.0 |
Database coverage of Candidate Erwinia sp. HY001006-1This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium atrosepticum | 1 | 99.1% | 0.0 |
Database coverage of Candidate Pectobacterium atrosepticumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Dickeya chrysanthemi | 2 | 99.1% | 0.0 |
Database coverage of Candidate Dickeya chrysanthemiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium sp. 2 | 1 | 99.1% | 0.0 |
Database coverage of Candidate Pectobacterium sp. 2This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium jejuense | 1 | 99.1% | 0.0 |
Database coverage of Candidate Pectobacterium jejuenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium sp. PL64 | 2 | 99.0% | 0.0 |
Database coverage of Candidate Pectobacterium sp. PL64This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium odoriferum | 2 | 99.0% | 0.0 |
Database coverage of Candidate Pectobacterium odoriferumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium parvum | 8 | 98.9% | 0.0 |
Database coverage of Candidate Pectobacterium parvumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium polaris | 12 | 98.9% | 0.0 |
Database coverage of Candidate Pectobacterium polarisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
BLAST search results
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | MN393951 | Pectobacterium carotovorum subsp. brasiliense strain PJ1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 2 | LC146475 | Pectobacterium carotovorum subsp. brasiliense gene for 16S ribosomal RNA, partial sequence, strain: kbs-2 | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 3 | LC645699 | Pectobacterium brasiliense MHPcb2101 gene for 16S rRNA, partial sequence | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 4 | LC685064 | Pectobacterium brasiliense MHPb2102 gene for 16S rRNA, partial sequence | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 5 | MN393955 | Pectobacterium carotovorum subsp. brasiliense strain PJ21 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 6 | CP065031 | Pectobacterium brasiliense strain F126 chromosome, complete genome | 1312 | 100.0% | 18125.309999999998 | 0.00e+00 | 99.8% |
| 7 | PP587582 | Pectobacterium brasiliense strain J26_S26 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 8 | MN393967 | Pectobacterium carotovorum subsp. brasiliense strain PZ13 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 9 | MN393930 | Pectobacterium carotovorum subsp. brasiliense strain HNP201706 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 10 | LC146474 | Pectobacterium carotovorum subsp. brasiliense gene for 16S ribosomal RNA, partial sequence, strain: kbs-1 | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 11 | JF926720 | Pectobacterium carotovorum subsp. brasiliense strain 1033 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 12 | KY021028 | Pectobacterium brasiliense strain KC07 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 13 | LC146476 | Pectobacterium carotovorum subsp. brasiliense gene for 16S ribosomal RNA, partial sequence, strain: pcbm-1 | 1312 | 100.0% | 2589.33 | 0.00e+00 | 99.8% |
| 14 | PP758419 | Pectobacterium sp. strain B22-2 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2567.52 | 0.00e+00 | 99.8% |
| 15 | MK910258 | Pectobacterium brasiliense strain ZYC5 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2561.58 | 0.00e+00 | 99.8% |
| 16 | MK910247 | Pectobacterium brasiliense strain WBC28 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2561.58 | 0.00e+00 | 99.8% |
| 17 | MK910256 | Pectobacterium brasiliense strain ZYC3 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2559.59 | 0.00e+00 | 99.8% |
| 18 | MK910257 | Pectobacterium brasiliense strain ZYC4 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2557.61 | 0.00e+00 | 99.8% |
| 19 | MT240621 | Pectobacterium brasiliense strain 1b 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2549.68 | 0.00e+00 | 99.8% |
| 20 | MN393890 | Candidatus Pectobacterium maceratum strain HNP201705 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2549.68 | 0.00e+00 | 99.8% |
| 21 | MT240620 | Pectobacterium brasiliense strain 2b 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2549.68 | 0.00e+00 | 99.8% |
| 22 | KX377593 | Pectobacterium brasiliense strain Pcb-zj-1 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2549.68 | 0.00e+00 | 99.8% |
| 23 | MH888014 | Pectobacterium brasiliense strain J-MHS 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2549.68 | 0.00e+00 | 99.8% |
| 24 | MT240615 | Pectobacterium brasiliense strain 7b 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2549.68 | 0.00e+00 | 99.8% |
| 25 | MN393937 | Pectobacterium carotovorum subsp. brasiliense strain HNP201729 16S ribosomal RNA gene, partial sequence | 1271 | 96.9% | 2508.05 | 0.00e+00 | 99.8% |
| 26 | OP005481 | Pectobacterium brasiliense strain CY-1 16S ribosomal RNA gene, partial sequence | 1269 | 96.7% | 2504.09 | 0.00e+00 | 99.8% |
| 27 | OP941559 | Pectobacterium aroidearum strain WC19240 16S ribosomal RNA gene, partial sequence | 1260 | 96.0% | 2486.25 | 0.00e+00 | 99.8% |
| 28 | OP941558 | Pectobacterium brasiliense strain GY19111 16S ribosomal RNA gene, partial sequence | 1260 | 96.0% | 2486.25 | 0.00e+00 | 99.8% |
| 29 | OP941537 | Pectobacterium brasiliense strain JN18131 16S ribosomal RNA gene, partial sequence | 1260 | 96.0% | 2486.25 | 0.00e+00 | 99.8% |
| 30 | OP941535 | Pectobacterium brasiliense strain TP19110 16S ribosomal RNA gene, partial sequence | 1260 | 96.0% | 2486.25 | 0.00e+00 | 99.8% |
| 31 | CP059960 | Pectobacterium brasiliense strain IPO:4060 NAK:251 chromosome, complete genome | 1312 | 100.0% | 18101.52 | 0.00e+00 | 99.7% |
| 32 | CP059963 | Pectobacterium brasiliense strain IPO:3649 NAK:375 chromosome, complete genome | 1312 | 100.0% | 18091.61 | 0.00e+00 | 99.7% |
| 33 | CP059962 | Pectobacterium brasiliense strain IPO:3710 NAK:380 chromosome, complete genome | 1312 | 100.0% | 18101.52 | 0.00e+00 | 99.7% |
| 34 | CP059957 | Pectobacterium brasiliense strain IPO:4071 NAK:240 chromosome, complete genome | 1312 | 100.0% | 18093.59 | 0.00e+00 | 99.7% |
| 35 | CP092039 | Pectobacterium brasiliense strain 130 chromosome, complete genome | 1312 | 100.0% | 18101.52 | 0.00e+00 | 99.7% |
| 36 | CP059955 | Pectobacterium brasiliense strain IPO:4134 NAK:395 chromosome, complete genome | 1312 | 100.0% | 18101.52 | 0.00e+00 | 99.7% |
| 37 | CP059961 | Pectobacterium brasiliense strain IPO:4057 NAK:249 chromosome, complete genome | 1312 | 100.0% | 18101.52 | 0.00e+00 | 99.7% |
| 38 | CP059958 | Pectobacterium brasiliense strain IPO:4065 NAK:223 chromosome, complete genome | 1312 | 100.0% | 18101.52 | 0.00e+00 | 99.7% |
| 39 | NR_159925 | Pectobacterium aroidearum strain SCRI 109 16S ribosomal RNA, partial sequence | 1312 | 100.0% | 2583.38 | 0.00e+00 | 99.7% |
| 40 | OR066160 | Pectobacterium brasiliense strain ESRB-4 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 41 | OR066157 | Pectobacterium brasiliense strain ESRB-1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 42 | MN393960 | Pectobacterium carotovorum subsp. brasiliense strain PJP201703 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 43 | LC781540 | Pectobacterium brasiliense MHPecto2204 gene for 16S rRNA, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 44 | MN393956 | Pectobacterium carotovorum subsp. brasiliense strain PJ22 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 45 | OR066159 | Pectobacterium brasiliense strain ESRB-3 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 46 | MN393948 | Pectobacterium carotovorum subsp. brasiliense strain PB1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 47 | OQ519692 | Pectobacterium brasiliense strain BS1113 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 48 | PP587572 | Pectobacterium brasiliense strain J13_S14 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 49 | MN393952 | Pectobacterium carotovorum subsp. brasiliense strain PJ7 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 50 | MN393957 | Pectobacterium carotovorum subsp. brasiliense strain PJ23 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 51 | OR066158 | Pectobacterium brasiliense strain ESRB-2 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 52 | KF385098 | Uncultured Erwinia sp. clone OTUr28 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 53 | KY021040 | Pectobacterium brasiliense strain KC28 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 54 | MN393903 | Candidatus Pectobacterium maceratum strain PJ17 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 55 | MN393949 | Pectobacterium carotovorum subsp. brasiliense strain PB2 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 56 | JF926718 | Pectobacterium carotovorum subsp. brasiliense strain C18 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 57 | MN393966 | Pectobacterium carotovorum subsp. brasiliense strain PZ9 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2581.4 | 0.00e+00 | 99.7% |
| 58 | GQ105516 | Uncultured bacterium clone nbw528d10c1 16S ribosomal RNA gene, partial sequence | 1311 | 99.9% | 2579.42 | 0.00e+00 | 99.7% |
| 59 | ON982467 | Pectobacterium brasiliense strain BDQ1 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2559.59 | 0.00e+00 | 99.7% |
| 60 | EU364834 | Pectobacterium carotovorum subsp. carotovorum 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2559.59 | 0.00e+00 | 99.7% |
| 61 | KP274903 | Pectobacterium carotovorum subsp. carotovorum strain BGZ-1 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2559.59 | 0.00e+00 | 99.7% |
| 62 | KP187491 | Pectobacterium carotovorum subsp. brasiliense strain Y11 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2553.65 | 0.00e+00 | 99.7% |
| 63 | OL449523 | Pectobacterium sp. strain HNP201707 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2551.66 | 0.00e+00 | 99.7% |
| 64 | KP187523 | Pectobacterium carotovorum subsp. brasiliense strain Y65 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2551.66 | 0.00e+00 | 99.7% |
| 65 | MN393931 | Pectobacterium carotovorum subsp. brasiliense strain HNP201708 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2551.66 | 0.00e+00 | 99.7% |
| 66 | KP187487 | Pectobacterium carotovorum subsp. brasiliense strain Y05 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2551.66 | 0.00e+00 | 99.7% |
| 67 | MN393932 | Pectobacterium carotovorum subsp. brasiliense strain HNP201709 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2551.66 | 0.00e+00 | 99.7% |
| 68 | MK910255 | Pectobacterium brasiliense strain ZYC2 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2551.66 | 0.00e+00 | 99.7% |
| 69 | MK910246 | Pectobacterium brasiliense strain WBC26 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2551.66 | 0.00e+00 | 99.7% |
| 70 | MK910254 | Pectobacterium brasiliense strain ZYC1 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2549.68 | 0.00e+00 | 99.7% |
| 71 | MN393920 | Pectobacterium carotovorum subsp. brasiliense strain BP201609 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2549.68 | 0.00e+00 | 99.7% |
| 72 | MN393922 | Pectobacterium carotovorum subsp. brasiliense strain BP201611 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2545.72 | 0.00e+00 | 99.7% |
| 73 | MH888009 | Pectobacterium brasiliense strain A-MH 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2541.75 | 0.00e+00 | 99.7% |
| 74 | MN393940 | Pectobacterium carotovorum subsp. brasiliense strain JP7 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2541.75 | 0.00e+00 | 99.7% |
| 75 | MH891619 | Pectobacterium brasiliense strain CK5 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2541.75 | 0.00e+00 | 99.7% |
| 76 | MH888010 | Pectobacterium brasiliense strain F-MH 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2541.75 | 0.00e+00 | 99.7% |
| 77 | KX377594 | Pectobacterium brasiliense strain Pcb-zj-2 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2541.75 | 0.00e+00 | 99.7% |
| 78 | JF721959 | Pectobacterium carotovorum subsp. carotovorum strain PCC1000 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2541.75 | 0.00e+00 | 99.7% |
| 79 | KX066076 | Pectobacterium brasiliense strain PVCT 203.1.1 16S ribosomal RNA gene, partial sequence | 1290 | 98.3% | 2537.79 | 0.00e+00 | 99.7% |
| 80 | MN393923 | Pectobacterium carotovorum subsp. brasiliense strain GWP201701 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2533.82 | 0.00e+00 | 99.7% |
| 81 | MH888019 | Pectobacterium brasiliense strain K-DOK 16S ribosomal RNA gene, partial sequence | 1275 | 97.2% | 2508.05 | 0.00e+00 | 99.7% |
| 82 | MN393928 | Pectobacterium carotovorum subsp. brasiliense strain HNP201703 16S ribosomal RNA gene, partial sequence | 1273 | 97.0% | 2504.09 | 0.00e+00 | 99.7% |
| 83 | KR265429 | Pectobacterium carotovorum strain VRBG-36 16S ribosomal RNA gene, partial sequence | 1271 | 96.9% | 2500.13 | 0.00e+00 | 99.7% |
| 84 | OL958698 | Pectobacterium brasiliense strain ZB21312 16S ribosomal RNA gene, partial sequence | 1271 | 96.9% | 2500.13 | 0.00e+00 | 99.7% |
| 85 | OL958697 | Pectobacterium brasiliense strain ZB21311 16S ribosomal RNA gene, partial sequence | 1271 | 96.9% | 2500.13 | 0.00e+00 | 99.7% |
| 86 | MH031784 | Pectobacterium carotovorum subsp. brasiliense strain KFB 392 16S ribosomal RNA gene, partial sequence | 1269 | 96.7% | 2496.16 | 0.00e+00 | 99.7% |
| 87 | MK823384 | Bacterium strain BS0196 16S ribosomal RNA gene, partial sequence | 1267 | 96.6% | 2492.2 | 0.00e+00 | 99.7% |
| 88 | CP046380 | Pectobacterium brasiliense strain HNP201719 chromosome, complete genome | 1312 | 100.0% | 18022.22 | 0.00e+00 | 99.6% |
| 89 | CP059956 | Pectobacterium brasiliense strain IPO:4132 NAK:239 chromosome, complete genome | 1312 | 100.0% | 18014.29 | 0.00e+00 | 99.6% |
| 90 | PQ559888 | Pectobacterium sp. strain DL6-4 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 91 | MN393946 | Pectobacterium carotovorum subsp. brasiliense strain MYP201709 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 92 | KY021041 | Pectobacterium brasiliense strain KC29 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 93 | MN393945 | Pectobacterium carotovorum subsp. brasiliense strain MYP201708 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 94 | PP587601 | Pectobacterium brasiliense strain J45_S45 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 95 | KY021029 | Pectobacterium brasiliense strain KC08 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 96 | JF926721 | Pectobacterium carotovorum subsp. brasiliense strain A17 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 97 | GU936981 | Pectobacterium carotovorum subsp. carotovorum strain KNU28198 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 98 | MN393954 | Pectobacterium carotovorum subsp. brasiliense strain PJ18 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 99 | MN393968 | Pectobacterium carotovorum subsp. brasiliense strain PZ14 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2573.47 | 0.00e+00 | 99.6% |
| 100 | GQ105437 | Uncultured bacterium clone nbw527e07c1 16S ribosomal RNA gene, partial sequence | 1311 | 99.9% | 2571.49 | 0.00e+00 | 99.6% |
| 101 | OP941531 | Pectobacterium brasiliense strain ZRIMU1031 16S ribosomal RNA gene, partial sequence | 1308 | 99.7% | 2565.54 | 0.00e+00 | 99.6% |
| 102 | KU997680 | Pectobacterium brasiliense strain HG1501090306 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2549.68 | 0.00e+00 | 99.6% |
| 103 | KU997677 | Pectobacterium brasiliense strain HG1501090303 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2549.68 | 0.00e+00 | 99.6% |
| 104 | KU997683 | Pectobacterium brasiliense strain HG1501090309 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2549.68 | 0.00e+00 | 99.6% |
| 105 | KU997678 | Pectobacterium brasiliense strain HG1501090304 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2549.68 | 0.00e+00 | 99.6% |
| 106 | KU997679 | Pectobacterium brasiliense strain HG1501090305 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2549.68 | 0.00e+00 | 99.6% |
| 107 | KP187510 | Pectobacterium carotovorum subsp. brasiliense strain Y45 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2545.72 | 0.00e+00 | 99.6% |
| 108 | KP187505 | Pectobacterium carotovorum subsp. brasiliense strain Y35 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2543.74 | 0.00e+00 | 99.6% |
| 109 | KU997681 | Pectobacterium brasiliense strain HG1501090307 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2543.74 | 0.00e+00 | 99.6% |
| 110 | LC782270 | Pectobacterium brasiliense KNUB-09-21 gene for 16S rRNA, partial sequence | 1292 | 98.5% | 2541.75 | 0.00e+00 | 99.6% |
| 111 | MK910250 | Pectobacterium brasiliense strain ZBC4 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2541.75 | 0.00e+00 | 99.6% |
| 112 | MH887750 | Pectobacterium brasiliense strain CK301 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2533.82 | 0.00e+00 | 99.6% |
| 113 | PV174387 | Pectobacterium brasiliense strain SZCX 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2533.82 | 0.00e+00 | 99.6% |
| 114 | OP216788 | Pectobacterium carotovorum strain CB2D1 16S ribosomal RNA gene, partial sequence | 1291 | 98.4% | 2531.84 | 0.00e+00 | 99.6% |
| 115 | PQ538625 | Pectobacterium brasiliense strain GYUN-860 16S ribosomal RNA gene, partial sequence | 1291 | 98.4% | 2531.84 | 0.00e+00 | 99.6% |
| 116 | MN393944 | Pectobacterium carotovorum subsp. brasiliense strain MYP201707 16S ribosomal RNA gene, partial sequence | 1290 | 98.3% | 2529.86 | 0.00e+00 | 99.6% |
| 117 | PQ559889 | Pectobacterium sp. strain DL10-2-1 16S ribosomal RNA gene, partial sequence | 1289 | 98.2% | 2527.88 | 0.00e+00 | 99.6% |
| 118 | MK824469 | Bacterium strain BS1281 16S ribosomal RNA gene, partial sequence | 1288 | 98.2% | 2525.9 | 0.00e+00 | 99.6% |
| 119 | OM909040 | Pectobacterium brasiliense strain DFLB4 16S ribosomal RNA gene, partial sequence | 1288 | 98.2% | 2525.9 | 0.00e+00 | 99.6% |
| 120 | JN185669 | Pectobacterium carotovorum strain sd-2 16S ribosomal RNA gene, partial sequence | 1271 | 96.9% | 2492.2 | 0.00e+00 | 99.6% |
| 121 | OP005474 | Pectobacterium brasiliense strain ECC17 16S ribosomal RNA gene, partial sequence | 1269 | 96.7% | 2488.23 | 0.00e+00 | 99.6% |
| 122 | LC473991 | Pectobacterium sp. 013 gene for 16S ribosomal RNA, partial sequence | 1268 | 96.6% | 2486.25 | 0.00e+00 | 99.6% |
| 123 | CP113504 | Pectobacterium brasiliense strain 21PCA_AGRO2 chromosome, complete genome | 1312 | 100.0% | 17935.0 | 0.00e+00 | 99.5% |
| 124 | CP020350 | Pectobacterium brasiliense strain SX309 chromosome, complete genome | 1312 | 100.0% | 17919.13 | 0.00e+00 | 99.5% |
| 125 | CP024780 | Pectobacterium brasiliense strain BZA12 chromosome, complete genome | 1312 | 100.0% | 17935.0 | 0.00e+00 | 99.5% |
| 126 | CP009769 | Pectobacterium carotovorum subsp. brasiliense strain BC1, complete genome | 1312 | 100.0% | 17905.26 | 0.00e+00 | 99.5% |
| 127 | CP063241 | Pectobacterium brasiliense strain ZLMLSHJ5 chromosome, complete genome | 1312 | 100.0% | 17909.239999999998 | 0.00e+00 | 99.5% |
| 128 | KY021037 | Pectobacterium brasiliense strain KC25 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2565.54 | 0.00e+00 | 99.5% |
| 129 | KT343633 | Pectobacterium carotovorum subsp. brasiliense strain Q34 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2565.54 | 0.00e+00 | 99.5% |
| 130 | CP085633 | Pectobacterium brasiliense strain TS20HJ1 chromosome, complete genome | 1312 | 100.0% | 17958.78 | 0.00e+00 | 99.5% |
| 131 | KY021042 | Pectobacterium brasiliense strain KC30 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2565.54 | 0.00e+00 | 99.5% |
| 132 | JF926717 | Pectobacterium carotovorum subsp. brasiliense strain 1073 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2565.54 | 0.00e+00 | 99.5% |
| 133 | KF066993 | Uncultured bacterium clone nbw693g11c1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2565.54 | 0.00e+00 | 99.5% |
| 134 | MK823333 | Bacterium strain BS0145 16S ribosomal RNA gene, partial sequence | 1311 | 99.9% | 2561.58 | 0.00e+00 | 99.5% |
| 135 | JF926724 | Pectobacterium carotovorum subsp. brasiliense strain 8 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2561.58 | 0.00e+00 | 99.5% |
| 136 | FJ593029 | Pectobacterium carotovorum subsp. carotovorum strain 301950 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2559.59 | 0.00e+00 | 99.5% |
| 137 | GU936994 | Pectobacterium carotovorum subsp. carotovorum strain KNU28211 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2557.61 | 0.00e+00 | 99.5% |
| 138 | KY021033 | Pectobacterium brasiliense strain KC18 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2557.61 | 0.00e+00 | 99.5% |
| 139 | KY021043 | Pectobacterium brasiliense strain KC04 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2557.61 | 0.00e+00 | 99.5% |
| 140 | LC379878 | Pectobacterium carotovorum subsp. brasiliense RAD1 gene for 16S ribosomal RNA, complete sequence | 1312 | 100.0% | 2557.61 | 0.00e+00 | 99.5% |
| 141 | MN393947 | Pectobacterium carotovorum subsp. brasiliense strain MYP201710 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2557.61 | 0.00e+00 | 99.5% |
| 142 | MK910240 | Pectobacterium brasiliense strain WBC14 16S ribosomal RNA gene, partial sequence | 1310 | 99.8% | 2557.61 | 0.00e+00 | 99.5% |
| 143 | AY207086 | Pectobacterium carotovorum subsp. brasiliensis strain 8 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2557.61 | 0.00e+00 | 99.5% |
| 144 | KY021032 | Pectobacterium brasiliense strain KC13 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2557.61 | 0.00e+00 | 99.5% |
| 145 | JF926723 | Pectobacterium carotovorum subsp. brasiliense strain 8 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2557.61 | 0.00e+00 | 99.5% |
| 146 | OP941533 | Pectobacterium brasiliense strain ZRIMU1030 16S ribosomal RNA gene, partial sequence | 1311 | 99.9% | 2555.63 | 0.00e+00 | 99.5% |
| 147 | OK644462 | Pectobacterium brasiliense strain P-3-5 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2553.65 | 0.00e+00 | 99.5% |
| 148 | MK824733 | Bacterium strain BS1545 16S ribosomal RNA gene, partial sequence | 1304 | 99.4% | 2547.7 | 0.00e+00 | 99.5% |
| 149 | OP476350 | Pectobacterium versatile strain ZRIMU1366 16S ribosomal RNA gene, partial sequence | 1307 | 99.6% | 2547.7 | 0.00e+00 | 99.5% |
| 150 | KU997684 | Pectobacterium brasiliense strain HG1501090310 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2543.74 | 0.00e+00 | 99.5% |
| 151 | KU997676 | Pectobacterium brasiliense strain HG1501090302 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2543.74 | 0.00e+00 | 99.5% |
| 152 | KU997682 | Pectobacterium brasiliense strain HG1501090308 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2543.74 | 0.00e+00 | 99.5% |
| 153 | MK910242 | Pectobacterium brasiliense strain WYC5 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2541.75 | 0.00e+00 | 99.5% |
| 154 | KP187498 | Pectobacterium carotovorum subsp. brasiliense strain Y21 16S ribosomal RNA gene, partial sequence | 1304 | 99.4% | 2541.75 | 0.00e+00 | 99.5% |
| 155 | OM333246 | Pectobacterium brasiliense strain SJDR 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2541.75 | 0.00e+00 | 99.5% |
| 156 | KP187519 | Pectobacterium carotovorum subsp. brasiliense strain Y58 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2539.77 | 0.00e+00 | 99.5% |
| 157 | MT040833 | Pectobacterium brasiliense strain BC1 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2535.81 | 0.00e+00 | 99.5% |
| 158 | KP187484 | Pectobacterium carotovorum subsp. brasiliense strain Y02 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2535.81 | 0.00e+00 | 99.5% |
| 159 | MH778576 | Pectobacterium brasiliense strain WYC1 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2535.81 | 0.00e+00 | 99.5% |
| 160 | KP187503 | Pectobacterium carotovorum subsp. brasiliense strain Y33 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2535.81 | 0.00e+00 | 99.5% |
| 161 | MT040834 | Pectobacterium brasiliense strain BC1 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2535.81 | 0.00e+00 | 99.5% |
| 162 | KP187490 | Pectobacterium carotovorum subsp. brasiliense strain Y08 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2535.81 | 0.00e+00 | 99.5% |
| 163 | EU678364 | Pectobacterium carotovorum subsp. carotovorum strain PccS1 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2535.81 | 0.00e+00 | 99.5% |
| 164 | MT040764 | Pectobacterium brasiliense strain BC1 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2535.81 | 0.00e+00 | 99.5% |
| 165 | MT040835 | Pectobacterium brasiliense strain BC1 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2535.81 | 0.00e+00 | 99.5% |
| 166 | MZ853521 | Pectobacterium brasiliense strain TS20HJ2_16S 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2533.82 | 0.00e+00 | 99.5% |
| 167 | MZ853520 | Pectobacterium brasiliense strain TS20HJ1_16S 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2533.82 | 0.00e+00 | 99.5% |
| 168 | JF721958 | Pectobacterium carotovorum subsp. carotovorum strain HNXDT002 16S ribosomal RNA gene, partial sequence | 1299 | 99.0% | 2531.84 | 0.00e+00 | 99.5% |
| 169 | KP187522 | Pectobacterium carotovorum subsp. brasiliense strain Y64 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2529.86 | 0.00e+00 | 99.5% |
| 170 | OK559728 | Pectobacterium brasiliense strain QB-1 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2529.86 | 0.00e+00 | 99.5% |
| 171 | KP187506 | Pectobacterium carotovorum subsp. brasiliense strain Y36 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2527.88 | 0.00e+00 | 99.5% |
| 172 | MN393942 | Pectobacterium carotovorum subsp. brasiliense strain MYP201605 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2525.9 | 0.00e+00 | 99.5% |
| 173 | KC762215 | Pectobacterium carotovorum subsp. brasiliense strain HG12031601 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2525.9 | 0.00e+00 | 99.5% |
| 174 | MH887754 | Pectobacterium brasiliense strain PY1 16S ribosomal RNA gene, partial sequence | 1291 | 98.4% | 2523.91 | 0.00e+00 | 99.5% |
| 175 | OM909038 | Pectobacterium brasiliense strain DFLB1 16S ribosomal RNA gene, partial sequence | 1288 | 98.2% | 2519.95 | 0.00e+00 | 99.5% |
| 176 | MN393927 | Pectobacterium carotovorum subsp. brasiliense strain HNP201702 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2519.95 | 0.00e+00 | 99.5% |
| 177 | MH887752 | Pectobacterium brasiliense strain CK302 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2517.97 | 0.00e+00 | 99.5% |
| 178 | OM909039 | Pectobacterium brasiliense strain DFLB2 16S ribosomal RNA gene, partial sequence | 1288 | 98.2% | 2512.02 | 0.00e+00 | 99.5% |
| 179 | MN393935 | Pectobacterium carotovorum subsp. brasiliense strain HNP201719 16S ribosomal RNA gene, partial sequence | 1283 | 97.8% | 2498.14 | 0.00e+00 | 99.5% |
| 180 | JN185670 | Pectobacterium carotovorum strain sd-3 16S ribosomal RNA gene, partial sequence | 1281 | 97.6% | 2498.14 | 0.00e+00 | 99.5% |
| 181 | MH888016 | Pectobacterium brasiliense strain D-DAK 16S ribosomal RNA gene, partial sequence | 1275 | 97.2% | 2492.2 | 0.00e+00 | 99.5% |
| 182 | KF447400 | Pectobacterium carotovorum strain XB66 16S ribosomal RNA gene, partial sequence | 1279 | 97.5% | 2492.2 | 0.00e+00 | 99.5% |
| 183 | CP096821 | Pectobacterium sp. 21LCBS03 chromosome, complete genome | 1312 | 100.0% | 17847.78 | 0.00e+00 | 99.4% |
| 184 | CP136134 | Pectobacterium brasiliense strain ZRIMU1701SM chromosome, complete genome | 1312 | 100.0% | 17822.0 | 0.00e+00 | 99.4% |
| 185 | CP136135 | Pectobacterium brasiliense strain ZRIMU1702DQ chromosome, complete genome | 1312 | 100.0% | 17827.95 | 0.00e+00 | 99.4% |
| 186 | JF926725 | Pectobacterium carotovorum subsp. brasiliense strain 317 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2549.68 | 0.00e+00 | 99.4% |
| 187 | PP587577 | Pectobacterium brasiliense strain J20_S20 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2549.68 | 0.00e+00 | 99.4% |
| 188 | KY021036 | Pectobacterium brasiliense strain KC22 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2549.68 | 0.00e+00 | 99.4% |
| 189 | MH778575 | Pectobacterium brasiliense strain WQC3 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2547.7 | 0.00e+00 | 99.4% |
| 190 | MK910243 | Pectobacterium brasiliense strain WBC16 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2545.72 | 0.00e+00 | 99.4% |
| 191 | MK910241 | Pectobacterium brasiliense strain WBC15 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2545.72 | 0.00e+00 | 99.4% |
| 192 | MK824732 | Bacterium strain BS1544 16S ribosomal RNA gene, partial sequence | 1311 | 99.9% | 2545.72 | 0.00e+00 | 99.4% |
| 193 | MK674243 | Pectobacterium brasiliense strain KP1 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2529.86 | 0.00e+00 | 99.4% |
| 194 | PQ148817 | Pectobacterium sp. strain ICMP 7853 16S ribosomal RNA gene, partial sequence | 1306 | 99.5% | 2529.86 | 0.00e+00 | 99.4% |
| 195 | MN393959 | Pectobacterium carotovorum subsp. brasiliense strain PJP201702 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2529.86 | 0.00e+00 | 99.4% |
| 196 | OR647597 | Pectobacterium brasiliense strain A8 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2521.93 | 0.00e+00 | 99.4% |
| 197 | OR143405 | Pectobacterium sp. strain 22LXZD03-5 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 198 | JF926750 | Pectobacterium carotovorum subsp. carotovorum strain C412.4 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 199 | PQ559887 | Pectobacterium sp. strain BSHS4 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 200 | GU936988 | Pectobacterium carotovorum subsp. carotovorum strain KNU28205 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 201 | PP494746 | Pectobacterium aroidearum strain ZRIMU5125 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 202 | KY021030 | Pectobacterium brasiliense strain KC09 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 203 | KY021035 | Pectobacterium brasiliense strain KC21 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 204 | KY021038 | Pectobacterium brasiliense strain KC26 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 205 | KY021034 | Pectobacterium brasiliense strain KC19 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 206 | PQ559886 | Pectobacterium sp. strain 21LCBS02 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 207 | CP128509 | Pectobacterium brasiliense strain PCC1 chromosome | 1312 | 100.0% | 2541.75 | 0.00e+00 | 99.3% |
| 208 | MH778577 | Pectobacterium brasiliense strain WYC2 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2539.77 | 0.00e+00 | 99.3% |
| 209 | GU936995 | Pectobacterium carotovorum subsp. carotovorum strain KNU28212 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2539.77 | 0.00e+00 | 99.3% |
| 210 | MH778579 | Pectobacterium brasiliense strain WYC6 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2537.79 | 0.00e+00 | 99.3% |
| 211 | MK824763 | Bacterium strain BS1575 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2537.79 | 0.00e+00 | 99.3% |
| 212 | KP187517 | Pectobacterium carotovorum subsp. brasiliense strain Y55 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2525.9 | 0.00e+00 | 99.3% |
| 213 | MN394024 | Pectobacterium carotovorum subsp. carotovorum strain PYP201702 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2525.9 | 0.00e+00 | 99.3% |
| 214 | MH778574 | Pectobacterium brasiliense strain WBC13 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2519.95 | 0.00e+00 | 99.3% |
| 215 | MT579567 | Pectobacterium carotovorum subsp. carotovorum strain JB63_16s 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2519.95 | 0.00e+00 | 99.3% |
| 216 | KT852368 | Pectobacterium carotovorum strain FM4 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2519.95 | 0.00e+00 | 99.3% |
| 217 | MN393964 | Pectobacterium carotovorum subsp. brasiliense strain PYP201709 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2515.98 | 0.00e+00 | 99.3% |
| 218 | MK024768 | Pectobacterium versatile strain IFB5169 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2514.0 | 0.00e+00 | 99.3% |
| 219 | KP187489 | Pectobacterium carotovorum subsp. brasiliense strain Y07 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2514.0 | 0.00e+00 | 99.3% |
| 220 | KP187501 | Pectobacterium carotovorum subsp. brasiliense strain Y31 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2514.0 | 0.00e+00 | 99.3% |
| 221 | MN393888 | Candidatus Pectobacterium maceratum strain GWP201710 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2514.0 | 0.00e+00 | 99.3% |
| 222 | OR647595 | Pectobacterium brasiliense strain A7 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2512.02 | 0.00e+00 | 99.3% |
| 223 | MZ379788 | Pectobacterium versatile strain FN20111 16S ribosomal RNA gene, partial sequence | 1295 | 98.7% | 2508.05 | 0.00e+00 | 99.3% |
| 224 | MZ379789 | Pectobacterium versatile strain FN20121 16S ribosomal RNA gene, partial sequence | 1295 | 98.7% | 2508.05 | 0.00e+00 | 99.3% |
| 225 | OK644469 | Pectobacterium brasiliense strain P-2-4 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2502.11 | 0.00e+00 | 99.3% |
| 226 | MN393941 | Pectobacterium carotovorum subsp. brasiliense strain MYP201602 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2502.11 | 0.00e+00 | 99.3% |
| 227 | MT240614 | Pectobacterium brasiliense strain 8b 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2502.11 | 0.00e+00 | 99.3% |
| 228 | CP003776 | Pectobacterium carotovorum subsp. carotovorum PCC21, complete genome | 1312 | 100.0% | 17695.15 | 0.00e+00 | 99.2% |
| 229 | CP173623 | Pectobacterium versatile strain M10 chromosome, complete genome | 1312 | 100.0% | 17720.9 | 0.00e+00 | 99.2% |
| 230 | CP086369 | Pectobacterium versatile strain A73-S18-O15 chromosome, complete genome | 1312 | 100.0% | 17685.23 | 0.00e+00 | 99.2% |
| 231 | GU936974 | Pectobacterium carotovorum subsp. carotovorum strain KNU28191 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2535.81 | 0.00e+00 | 99.2% |
| 232 | OK335744 | Pectobacterium sp. strain MMS21-Er7 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 233 | JF926745 | Pectobacterium carotovorum subsp. carotovorum strain C267 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 234 | JF926759 | Pectobacterium carotovorum subsp. brasiliense strain 1001 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 235 | KP836248 | Pectobacterium sp. CW5 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 236 | MN393899 | Candidatus Pectobacterium maceratum strain MYP201706 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 237 | AF373189 | Pectobacterium carotovorum subsp. carotovorum strain E161 gene, partial sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 238 | GQ105168 | Uncultured bacterium clone nbw526h08c1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 239 | JF926719 | Pectobacterium carotovorum subsp. brasiliense strain C18 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 240 | MN393904 | Candidatus Pectobacterium maceratum strain PR1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 241 | MN393909 | Candidatus Pectobacterium maceratum strain YY2.2 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.2% |
| 242 | MK356452 | Pectobacterium sp. strain ICMP 12182 16S ribosomal RNA gene, partial sequence | 1305 | 99.5% | 2531.84 | 0.00e+00 | 99.2% |
| 243 | KP187504 | Pectobacterium carotovorum subsp. brasiliense strain Y34 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2529.86 | 0.00e+00 | 99.2% |
| 244 | FJ595865 | Pectobacterium carotovorum subsp. carotovorum strain ECC301300 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2529.86 | 0.00e+00 | 99.2% |
| 245 | MN393882 | Candidatus Pectobacterium maceratum strain GCP201704 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 246 | LC851503 | Pectobacterium sp. MHPecto2420-1 gene for 16S rRNA, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 247 | NR_118224 | Pectobacterium brasiliense strain 212 16S ribosomal RNA, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 248 | MN393905 | Candidatus Pectobacterium maceratum strain PYP201701 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 249 | GU936982 | Pectobacterium carotovorum subsp. carotovorum strain KNU28199 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 250 | JF926744 | Pectobacterium carotovorum subsp. carotovorum strain C150 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 251 | CP173610 | Pectobacterium versatile strain M22b chromosome, complete genome | 1312 | 100.0% | 17681.3 | 0.00e+00 | 99.2% |
| 252 | MN393929 | Pectobacterium carotovorum subsp. brasiliense strain HNP201704 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 253 | MN393965 | Pectobacterium carotovorum subsp. brasiliense strain PZ7 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 254 | MN393893 | Candidatus Pectobacterium maceratum strain JR2 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 255 | JN106433 | Pectobacterium sp. W2Apr18 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 256 | MN393892 | Candidatus Pectobacterium maceratum strain JP12 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 257 | CP170503 | Pectobacterium brasiliense strain BSRLOP2CAB chromosome, complete genome | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 258 | AF373185 | Pectobacterium carotovorum subsp. carotovorum strain 21 gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 259 | OP941532 | Pectobacterium versatile strain ZRIMU1240 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 260 | PQ146559 | Pectobacterium brasiliense strain PB052001 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 261 | JQ771053 | Pectobacterium carotovorum subsp. brasiliensis NZEC1 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 262 | MN393990 | Pectobacterium carotovorum subsp. carotovorum strain HNP201713 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 263 | OP941539 | Pectobacterium brasiliense strain BX18121 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 264 | KY021056 | Pectobacterium carotovorum subsp. carotovorum strain KC24 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2525.9 | 0.00e+00 | 99.2% |
| 265 | MH778573 | Pectobacterium brasiliense strain WBC12 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2523.91 | 0.00e+00 | 99.2% |
| 266 | MK824723 | Bacterium strain BS1535 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2523.91 | 0.00e+00 | 99.2% |
| 267 | MH778560 | Pectobacterium carotovorum subsp. carotovorum strain WQC2 16S ribosomal RNA gene, partial sequence | 1310 | 99.8% | 2519.95 | 0.00e+00 | 99.2% |
| 268 | MK382467 | Pectobacterium sp. strain ICMP 7177 16S ribosomal RNA gene, partial sequence | 1306 | 99.5% | 2514.0 | 0.00e+00 | 99.2% |
| 269 | MT579573 | Pectobacterium carotovorum subsp. carotovorum strain JB100_16s 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2512.02 | 0.00e+00 | 99.2% |
| 270 | MG591822 | Pectobacterium carotovorum subsp. carotovorum strain GGH-4 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2512.02 | 0.00e+00 | 99.2% |
| 271 | MG591815 | Pectobacterium carotovorum subsp. carotovorum strain GJY-2 16S ribosomal RNA gene, partial sequence | 1304 | 99.4% | 2510.04 | 0.00e+00 | 99.2% |
| 272 | EU364836 | Erwinia sp. HY001006-1 16S ribosomal RNA gene, partial sequence | 1303 | 99.3% | 2510.04 | 0.00e+00 | 99.2% |
| 273 | KT852367 | Pectobacterium carotovorum strain FM3 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2510.04 | 0.00e+00 | 99.2% |
| 274 | KP187492 | Pectobacterium carotovorum subsp. brasiliense strain Y12 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2510.04 | 0.00e+00 | 99.2% |
| 275 | KY446033 | Pectobacterium carotovorum subsp. carotovorum strain B2436 16S ribosomal RNA gene, partial sequence | 1303 | 99.3% | 2508.05 | 0.00e+00 | 99.2% |
| 276 | KT852369 | Pectobacterium carotovorum strain FM6 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2508.05 | 0.00e+00 | 99.2% |
| 277 | KP187500 | Pectobacterium carotovorum subsp. brasiliense strain Y29 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2508.05 | 0.00e+00 | 99.2% |
| 278 | KY446032 | Pectobacterium carotovorum subsp. carotovorum strain A2436 16S ribosomal RNA gene, partial sequence | 1303 | 99.3% | 2508.05 | 0.00e+00 | 99.2% |
| 279 | OK644477 | Pectobacterium brasiliense strain GZ-2-1 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2506.07 | 0.00e+00 | 99.2% |
| 280 | JN185668 | Pectobacterium carotovorum strain sd-1 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2506.07 | 0.00e+00 | 99.2% |
| 281 | MK024769 | Pectobacterium versatile strain IFB5266 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2506.07 | 0.00e+00 | 99.2% |
| 282 | KP187516 | Pectobacterium carotovorum subsp. brasiliense strain Y54 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2506.07 | 0.00e+00 | 99.2% |
| 283 | OK644461 | Pectobacterium brasiliense strain P-2-1 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2504.09 | 0.00e+00 | 99.2% |
| 284 | KC790263 | Pectobacterium carotovorum subsp. carotovorum strain PN19 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2504.09 | 0.00e+00 | 99.2% |
| 285 | MN393901 | Candidatus Pectobacterium maceratum strain PDP201712 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2504.09 | 0.00e+00 | 99.2% |
| 286 | MG591823 | Pectobacterium carotovorum subsp. carotovorum strain NXN-3 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2502.11 | 0.00e+00 | 99.2% |
| 287 | MN393889 | Candidatus Pectobacterium maceratum strain GWP201712 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2502.11 | 0.00e+00 | 99.2% |
| 288 | KT222000 | Pectobacterium carotovorum subsp. carotovorum strain APEC14-07 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2502.11 | 0.00e+00 | 99.2% |
| 289 | MK910245 | Pectobacterium brasiliense strain WBC22 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2502.11 | 0.00e+00 | 99.2% |
| 290 | OK644465 | Pectobacterium brasiliense strain P-2-5 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2502.11 | 0.00e+00 | 99.2% |
| 291 | MH894218 | Pectobacterium brasiliense strain NJAU170 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2500.13 | 0.00e+00 | 99.2% |
| 292 | MT240617 | Pectobacterium brasiliense strain 5b 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2498.14 | 0.00e+00 | 99.2% |
| 293 | KC790299 | Pectobacterium carotovorum subsp. carotovorum strain RY32 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2498.14 | 0.00e+00 | 99.2% |
| 294 | MN393925 | Pectobacterium carotovorum subsp. brasiliense strain GWP201715 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2498.14 | 0.00e+00 | 99.2% |
| 295 | OM200137 | Pectobacterium versatile strain ICMP 6437 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2498.14 | 0.00e+00 | 99.2% |
| 296 | MT240616 | Pectobacterium brasiliense strain 6b 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2498.14 | 0.00e+00 | 99.2% |
| 297 | MK910249 | Pectobacterium brasiliense strain ZBC3 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2496.16 | 0.00e+00 | 99.2% |
| 298 | MK910253 | Pectobacterium brasiliense strain ZBC7 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2496.16 | 0.00e+00 | 99.2% |
| 299 | KP187513 | Pectobacterium carotovorum subsp. brasiliense strain Y49 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2496.16 | 0.00e+00 | 99.2% |
| 300 | MK910252 | Pectobacterium brasiliense strain ZBC6 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2496.16 | 0.00e+00 | 99.2% |
| 301 | MK910244 | Pectobacterium brasiliense strain WBC21 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2496.16 | 0.00e+00 | 99.2% |
| 302 | OQ568821 | Pectobacterium versatile strain YH03 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2494.18 | 0.00e+00 | 99.2% |
| 303 | OQ568819 | Pectobacterium versatile strain YH01 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2494.18 | 0.00e+00 | 99.2% |
| 304 | OQ568822 | Pectobacterium versatile strain YH04 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2494.18 | 0.00e+00 | 99.2% |
| 305 | OQ568820 | Pectobacterium versatile strain YH02 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2494.18 | 0.00e+00 | 99.2% |
| 306 | JQ740835 | Pectobacterium carotovorum subsp. carotovorum strain Ec101 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2492.2 | 0.00e+00 | 99.2% |
| 307 | CP034276 | Pectobacterium versatile strain 14A chromosome, complete genome | 1312 | 100.0% | 17609.920000000002 | 0.00e+00 | 99.1% |
| 308 | CP065143 | Pectobacterium versatile strain DSM 30169 chromosome | 1312 | 100.0% | 17641.65 | 0.00e+00 | 99.1% |
| 309 | CP021894 | Pectobacterium versatile strain SCC1 chromosome | 1312 | 100.0% | 17657.51 | 0.00e+00 | 99.1% |
| 310 | CP063242 | Pectobacterium carotovorum strain XP-13 chromosome, complete genome | 1312 | 100.0% | 17603.97 | 0.00e+00 | 99.1% |
| 311 | CP084655 | Pectobacterium brasiliense strain SR10 chromosome, complete genome | 1312 | 100.0% | 17641.65 | 0.00e+00 | 99.1% |
| 312 | AF373183 | Pectobacterium atrosepticum strain E1 gene, partial sequence | 1312 | 100.0% | 2521.93 | 0.00e+00 | 99.1% |
| 313 | AB680074 | Pectobacterium carotovorum subsp. carotovorum gene for 16S rRNA, partial sequence, strain: NBRC 3380 | 1312 | 100.0% | 2519.95 | 0.00e+00 | 99.1% |
| 314 | MK138642 | Pectobacterium carotovorum subsp. carotovorum strain IMCC34919 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 315 | MG591821 | Pectobacterium carotovorum subsp. carotovorum strain SJY-1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 316 | KY021053 | Pectobacterium carotovorum subsp. carotovorum strain KC17 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 317 | AY207085 | Pectobacterium carotovorum subsp. brasiliensis strain 371 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 318 | KY021052 | Pectobacterium carotovorum subsp. carotovorum strain KC15 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 319 | NR_118227 | Pectobacterium carotovorum strain CFBP2046 16S ribosomal RNA, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 320 | AF373188 | Pectobacterium carotovorum subsp. carotovorum strain E155 gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 321 | MN393908 | Candidatus Pectobacterium maceratum strain PZ8 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 322 | OK427285 | Pectobacterium carotovorum strain ZJ23 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 323 | MK823376 | Bacterium strain BS0188 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 324 | MN393907 | Candidatus Pectobacterium maceratum strain PZ4 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 325 | AF373187 | Pectobacterium carotovorum subsp. carotovorum strain 441 gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 326 | MN394034 | Pectobacterium carotovorum subsp. carotovorum strain PZ12 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 327 | GU936989 | Pectobacterium carotovorum subsp. carotovorum strain KNU28206 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 328 | MH915645 | Pectobacterium sp. strain PE 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 329 | JF926749 | Pectobacterium carotovorum subsp. carotovorum strain C412.4 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 330 | JF926748 | Pectobacterium carotovorum subsp. carotovorum strain C137 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 99.1% |
| 331 | MG890363 | Pectobacterium carotovorum strain 8419 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2515.98 | 0.00e+00 | 99.1% |
| 332 | MH778578 | Pectobacterium brasiliense strain WYC4 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2514.0 | 0.00e+00 | 99.1% |
| 333 | PP103283 | Pectobacterium brasiliense strain ICMP 10134 16S ribosomal RNA gene, partial sequence | 1306 | 99.5% | 2514.0 | 0.00e+00 | 99.1% |
| 334 | MG591827 | Pectobacterium carotovorum subsp. carotovorum strain QML-6 16S ribosomal RNA gene, partial sequence | 1307 | 99.6% | 2506.07 | 0.00e+00 | 99.1% |
| 335 | AF373174 | Erwinia chrysanthemi strain GSPB 413 16S ribosomal RNA gene, partial sequence | 1306 | 99.5% | 2504.09 | 0.00e+00 | 99.1% |
| 336 | MT579578 | Pectobacterium brasiliense strain JB127_16s 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2500.13 | 0.00e+00 | 99.1% |
| 337 | KY446034 | Pectobacterium carotovorum subsp. carotovorum strain C2436 16S ribosomal RNA gene, partial sequence | 1303 | 99.3% | 2500.13 | 0.00e+00 | 99.1% |
| 338 | KP187494 | Pectobacterium carotovorum subsp. brasiliense strain Y14 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 339 | MT040756 | Pectobacterium versatile strain SCC1 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 340 | MG591828 | Pectobacterium carotovorum subsp. carotovorum strain GDX-5 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 341 | MG591824 | Pectobacterium carotovorum subsp. carotovorum strain SJY-2 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 342 | KC790280 | Pectobacterium carotovorum subsp. carotovorum strain RN8 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 343 | KC790297 | Pectobacterium carotovorum subsp. carotovorum strain RY29 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 344 | MN393898 | Candidatus Pectobacterium maceratum strain MYP201704 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 345 | MT579579 | Pectobacterium carotovorum subsp. carotovorum strain JB133_16s 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 346 | KC790284 | Pectobacterium carotovorum subsp. carotovorum strain RN24 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 347 | KC790291 | Pectobacterium carotovorum subsp. carotovorum strain RY13 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2494.18 | 0.00e+00 | 99.1% |
| 348 | MN393943 | Pectobacterium carotovorum subsp. brasiliense strain MYP201701 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2492.2 | 0.00e+00 | 99.1% |
| 349 | MK024772 | Pectobacterium versatile strain IFB5214 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2490.21 | 0.00e+00 | 99.1% |
| 350 | OM200136 | Pectobacterium carotovorum subsp. carotovorum strain ICMP 6415 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2490.21 | 0.00e+00 | 99.1% |
| 351 | PP434479 | Pectobacterium carotovorum strain Pb9 16S ribosomal RNA gene, partial sequence | 1296 | 98.8% | 2490.21 | 0.00e+00 | 99.1% |
| 352 | KP187520 | Pectobacterium brasiliense strain Y60 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2490.21 | 0.00e+00 | 99.1% |
| 353 | MN393906 | Candidatus Pectobacterium maceratum strain PYP201714 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2488.23 | 0.00e+00 | 99.1% |
| 354 | FJ587222 | Pectobacterium sp. 2 16S ribosomal RNA gene, partial sequence | 1291 | 98.4% | 2488.23 | 0.00e+00 | 99.1% |
| 355 | KP187509 | Pectobacterium carotovorum subsp. brasiliense strain Y44 16S ribosomal RNA gene, partial sequence | 1298 | 98.9% | 2488.23 | 0.00e+00 | 99.1% |
| 356 | LC742805 | Pectobacterium sp. 13-115 gene for 16S ribosomal RNA, partial sequence | 1292 | 98.5% | 2486.25 | 0.00e+00 | 99.1% |
| 357 | JX258132 | Pectobacterium carotovorum strain 7-3-1 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2486.25 | 0.00e+00 | 99.1% |
| 358 | JX258133 | Pectobacterium carotovorum strain 7-3-2 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2486.25 | 0.00e+00 | 99.1% |
| 359 | MN393939 | Pectobacterium carotovorum subsp. brasiliense strain JP4 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2486.25 | 0.00e+00 | 99.1% |
| 360 | OR294312 | Pectobacterium carotovorum strain Pec-On 16S ribosomal RNA gene, partial sequence | 1297 | 98.9% | 2486.25 | 0.00e+00 | 99.1% |
| 361 | MN394010 | Pectobacterium carotovorum subsp. carotovorum strain PDP201714 16S ribosomal RNA gene, partial sequence | 1292 | 98.5% | 2486.25 | 0.00e+00 | 99.1% |
| 362 | CP047495 | Pectobacterium brasiliense strain 1692 chromosome, complete genome | 1312 | 100.0% | 17564.31 | 0.00e+00 | 99.0% |
| 363 | KP151652 | Pectobacterium carotovorum subsp. brasiliense 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2533.82 | 0.00e+00 | 99.0% |
| 364 | CP059959 | Pectobacterium brasiliense strain IPO:4062 NAK:237 chromosome, complete genome | 1312 | 100.0% | 17568.29 | 0.00e+00 | 99.0% |
| 365 | CP174195 | Pectobacterium carotovorum strain PCC27 chromosome, complete genome | 1312 | 100.0% | 17538.56 | 0.00e+00 | 99.0% |
| 366 | CP092070 | Pectobacterium sp. PL64 chromosome, complete genome | 1312 | 100.0% | 17532.62 | 0.00e+00 | 99.0% |
| 367 | NR_041971 | Pectobacterium carotovorum strain DSM 30168 16S ribosomal RNA, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 368 | JF926754 | Pectobacterium carotovorum subsp. carotovorum strain C338 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 369 | CP173625 | Pectobacterium carotovorum strain M8a chromosome, complete genome | 1312 | 100.0% | 17562.35 | 0.00e+00 | 99.0% |
| 370 | CP173624 | Pectobacterium carotovorum strain M8b chromosome, complete genome | 1312 | 100.0% | 17562.35 | 0.00e+00 | 99.0% |
| 371 | KY021045 | Pectobacterium carotovorum subsp. carotovorum strain KC01 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 372 | NR_118228 | Pectobacterium brasiliense strain 212 16S ribosomal RNA, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 373 | CP173627 | Pectobacterium carotovorum strain M4a chromosome, complete genome | 1312 | 100.0% | 17562.35 | 0.00e+00 | 99.0% |
| 374 | CP084741 | Pectobacterium carotovorum strain A077-S18-O15 chromosome, complete genome | 1312 | 100.0% | 17570.28 | 0.00e+00 | 99.0% |
| 375 | MN394025 | Pectobacterium carotovorum subsp. carotovorum strain PYP201703 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 376 | JF926736 | Pectobacterium carotovorum subsp. carotovorum strain A10.1 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 377 | NR_118226 | Pectobacterium carotovorum strain CFBP2046 16S ribosomal RNA, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 378 | CP173628 | Pectobacterium carotovorum strain M3 chromosome, complete genome | 1312 | 100.0% | 17562.35 | 0.00e+00 | 99.0% |
| 379 | MN393986 | Pectobacterium carotovorum subsp. carotovorum strain GWP201702 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 380 | MN394042 | Pectobacterium carotovorum subsp. odoriferum strain GP3 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 381 | KY021039 | Pectobacterium brasiliense strain KC27 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 382 | MG543053 | Pectobacterium brasiliense strain N3 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 383 | MG543052 | Pectobacterium brasiliense strain N2 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 384 | MG543051 | Pectobacterium brasiliense strain N1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 385 | MG543054 | Pectobacterium brasiliense strain N4 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 386 | MN393984 | Pectobacterium carotovorum subsp. carotovorum strain GP1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 387 | JX415822 | Pectobacterium carotovorum subsp. brasiliense strain PCB01 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 388 | LT595816 | Uncultured bacterium partial 16S rRNA gene, clone clone AF-35664 | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 389 | MN394032 | Pectobacterium carotovorum subsp. carotovorum strain PZ2 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 390 | LC782010 | Pectobacterium carotovorum MHPecto2103 gene for 16S ribosomal RNA, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 391 | CP034237 | Pectobacterium carotovorum subsp. carotovorum strain JR1.1 chromosome, complete genome | 1312 | 100.0% | 17538.56 | 0.00e+00 | 99.0% |
| 392 | GU936991 | Pectobacterium carotovorum subsp. carotovorum strain KNU28208 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2510.04 | 0.00e+00 | 99.0% |
| 393 | AF373203 | Erwinia chrysanthemi strain GSPB 1406 gene, partial sequence | 1312 | 100.0% | 2508.05 | 0.00e+00 | 99.0% |
| 394 | MG591826 | Pectobacterium carotovorum subsp. carotovorum strain QHX-3 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2508.05 | 0.00e+00 | 99.0% |
| 395 | MZ676043 | Pectobacterium sp. PL64 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2508.05 | 0.00e+00 | 99.0% |
| 396 | MK356444 | Pectobacterium carotovorum subsp. carotovorum strain ICMP 6017 16S ribosomal RNA gene, partial sequence | 1305 | 99.5% | 2496.16 | 0.00e+00 | 99.0% |
| 397 | KY446059 | Pectobacterium carotovorum subsp. carotovorum strain ICMP 13550 16S ribosomal RNA gene, partial sequence | 1305 | 99.5% | 2496.16 | 0.00e+00 | 99.0% |
| 398 | MK356447 | Pectobacterium carotovorum subsp. carotovorum strain ICMP 6016 16S ribosomal RNA gene, partial sequence | 1305 | 99.5% | 2496.16 | 0.00e+00 | 99.0% |
| 399 | NR_118855 | Pectobacterium carotovorum strain ATCC 15713 16S ribosomal RNA, partial sequence | 1302 | 99.2% | 2490.21 | 0.00e+00 | 99.0% |
| 400 | FJ593038 | Pectobacterium carotovorum subsp. carotovorum strain NWP-1 16S ribosomal RNA gene, partial sequence | 1302 | 99.2% | 2490.21 | 0.00e+00 | 99.0% |
| 401 | KC790305 | Pectobacterium carotovorum subsp. carotovorum strain SK17 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2490.21 | 0.00e+00 | 99.0% |
| 402 | FJ593035 | Pectobacterium carotovorum subsp. carotovorum strain PCP1 16S ribosomal RNA gene, partial sequence | 1302 | 99.2% | 2490.21 | 0.00e+00 | 99.0% |
| 403 | KP187514 | Pectobacterium carotovorum subsp. brasiliense strain Y52 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2488.23 | 0.00e+00 | 99.0% |
| 404 | MT579565 | Pectobacterium carotovorum subsp. carotovorum strain JB55_16s 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2488.23 | 0.00e+00 | 99.0% |
| 405 | KC790298 | Pectobacterium carotovorum subsp. carotovorum strain RY31 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2486.25 | 0.00e+00 | 99.0% |
| 406 | JX196705 | Pectobacterium carotovorum 16S ribosomal RNA gene, partial sequence | 1301 | 99.2% | 2486.25 | 0.00e+00 | 99.0% |
| 407 | AB681950 | Pectobacterium carotovorum subsp. carotovorum gene for 16S rRNA, partial sequence, strain: NBRC 103133 | 1312 | 100.0% | 2517.97 | 0.00e+00 | 98.9% |
| 408 | KY242459 | Pectobacterium carotovorum subsp. carotovorum strain MA3 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2517.97 | 0.00e+00 | 98.9% |
| 409 | CP063380 | Pectobacterium versatile strain ECC15 chromosome, complete genome | 1312 | 100.0% | 12508.55 | 0.00e+00 | 98.9% |
| 410 | CP117874 | Pectobacterium carotovorum subsp. carotovorum strain ZJ-4-2 chromosome, complete genome | 1312 | 100.0% | 17522.7 | 0.00e+00 | 98.9% |
| 411 | CP045098 | Pectobacterium carotovorum strain ZM1 chromosome, complete genome | 1312 | 100.0% | 17514.77 | 0.00e+00 | 98.9% |
| 412 | NR_119367 | Pectobacterium carotovorum strain LMG 2404 16S ribosomal RNA, partial sequence | 1312 | 100.0% | 2506.07 | 0.00e+00 | 98.9% |
| 413 | NR_115173 | Pectobacterium brasiliense strain 212 16S ribosomal RNA, partial sequence | 1312 | 100.0% | 2504.09 | 0.00e+00 | 98.9% |
| 414 | DQ333384 | Pectobacterium carotovorum subsp. carotovorum 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2504.09 | 0.00e+00 | 98.9% |
| 415 | MN394014 | Pectobacterium carotovorum subsp. carotovorum strain PDP201722 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 416 | KY021048 | Pectobacterium carotovorum subsp. carotovorum strain KC05 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 417 | GU936996 | Pectobacterium carotovorum subsp. carotovorum strain KNU28213 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 418 | OP941530 | Pectobacterium carotovorum strain NX18131 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 419 | MG251434 | Pectobacterium carotovorum strain PJ25.1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 420 | KY021046 | Pectobacterium carotovorum subsp. carotovorum strain KC02 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 421 | OP941526 | Pectobacterium parvum strain ZRIMU1020 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 422 | OP941525 | Pectobacterium parvum strain ZRIMU1019 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 423 | MN393878 | Pectobacterium polaris strain PZ1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 424 | MN393997 | Pectobacterium carotovorum subsp. carotovorum strain JR1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 425 | MN394021 | Pectobacterium carotovorum subsp. carotovorum strain PJP201708 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 426 | MH166802 | Pectobacterium parvum strain IFB5220 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 427 | MN394033 | Pectobacterium carotovorum subsp. carotovorum strain PZ3 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 428 | OP941562 | Pectobacterium carotovorum strain ZB18121 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 429 | FJ652619 | Pectobacterium carotovorum strain cc303 16S ribosomal RNA (rrsA) gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 430 | JF926756 | Pectobacterium carotovorum subsp. carotovorum strain M30 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 431 | KY021055 | Pectobacterium carotovorum subsp. carotovorum strain KC23 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 432 | KY021049 | Pectobacterium carotovorum subsp. carotovorum strain KC06 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 433 | MN394035 | Pectobacterium carotovorum subsp. carotovorum strain YY1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 434 | JF926733 | Pectobacterium carotovorum subsp. carotovorum strain SCRI 2 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 435 | GU362080 | Pectobacterium carotovorum subsp. carotovorum strain Ka3a 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 436 | CP034236 | Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome | 1312 | 100.0% | 17514.77 | 0.00e+00 | 98.9% |
| 437 | JF926738 | Pectobacterium carotovorum subsp. carotovorum strain A18 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 438 | OP941529 | Pectobacterium parvum strain ZRIMU1006 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 439 | ON314577 | Pectobacterium carotovorum subsp. carotovorum strain KJ-1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 440 | PQ586467 | Pectobacterium parvum strain SH-B 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 441 | OQ253459 | Pectobacterium carotovorum subsp. carotovorum strain Pecto-Iq 1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 442 | KY021054 | Pectobacterium carotovorum subsp. carotovorum strain KC16 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 443 | MN394023 | Pectobacterium carotovorum subsp. carotovorum strain PP3 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 444 | ON314578 | Pectobacterium carotovorum subsp. carotovorum strain KJ-3 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 445 | GU936978 | Pectobacterium carotovorum subsp. carotovorum strain KNU28195 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 446 | MN394003 | Pectobacterium carotovorum subsp. carotovorum strain MYP201712 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 447 | MN393983 | Pectobacterium carotovorum subsp. carotovorum strain GCP201705 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 448 | KY021047 | Pectobacterium carotovorum subsp. carotovorum strain KC03 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 449 | MN394007 | Pectobacterium carotovorum subsp. carotovorum strain PDP201706 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 450 | JF926741 | Pectobacterium carotovorum subsp. carotovorum strain C3 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 451 | MN393953 | Pectobacterium carotovorum subsp. brasiliense strain PJ15 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 452 | AB680280 | Pectobacterium carotovorum subsp. carotovorum gene for 16S rRNA, partial sequence, strain: NBRC 12380 | 1312 | 100.0% | 2502.11 | 0.00e+00 | 98.9% |
| 453 | CP046377 | Pectobacterium parvum strain PZ1 chromosome, complete genome | 1312 | 100.0% | 17514.77 | 0.00e+00 | 98.9% |
| 454 | MG890366 | Pectobacterium carotovorum strain 8694 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2500.13 | 0.00e+00 | 98.9% |
| 455 | MG890365 | Pectobacterium carotovorum strain 8693 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2500.13 | 0.00e+00 | 98.9% |
| 456 | EF102836 | Pectobacterium carotovorum strain G-1-5-1 16S ribosomal RNA gene, partial sequence | 1310 | 99.8% | 2500.13 | 0.00e+00 | 98.9% |
| 457 | MG654657 | Pectobacterium carotovorum subsp. carotovorum strain Pe1 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2498.14 | 0.00e+00 | 98.9% |
| 458 | GU936973 | Pectobacterium carotovorum subsp. carotovorum strain KNU28190 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2498.14 | 0.00e+00 | 98.9% |
| 459 | JF926753 | Pectobacterium carotovorum subsp. carotovorum strain C338 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2498.14 | 0.00e+00 | 98.9% |
| 460 | JF926740 | Pectobacterium carotovorum subsp. carotovorum strain C144 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2498.14 | 0.00e+00 | 98.9% |
| 461 | FJ593033 | Pectobacterium carotovorum subsp. carotovorum strain ECCN7129 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2498.14 | 0.00e+00 | 98.9% |
| 462 | HM581688 | Pectobacterium carotovorum subsp. carotovorum strain LY34 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2498.14 | 0.00e+00 | 98.9% |
| 463 | MG591816 | Pectobacterium carotovorum subsp. carotovorum strain QHL-2 16S ribosomal RNA gene, partial sequence | 1311 | 99.9% | 2496.16 | 0.00e+00 | 98.9% |
| 464 | MH935644 | Pectobacterium carotovorum subsp. carotovorum strain E6 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 465 | HE575581 | Uncultured Erwinia sp. partial 16S rRNA gene, isolate ELC0605, clone A0504G03 | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 466 | MZ604907 | Pectobacterium carotovorum subsp. carotovorum strain SBPC 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 467 | JF926755 | Pectobacterium carotovorum subsp. carotovorum strain M30 note sequence type I 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 468 | MN394016 | Pectobacterium carotovorum subsp. carotovorum strain PH5 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 469 | JF926760 | Pectobacterium carotovorum subsp. brasiliense strain 1001 note sequence type II 16S ribosomal RNA gene, complete sequence | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 470 | AY207084 | Pectobacterium carotovorum subsp. brasiliensis strain 213 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 471 | MN394018 | Pectobacterium carotovorum subsp. carotovorum strain PJ10 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 472 | MN394005 | Pectobacterium carotovorum subsp. carotovorum strain MYP201714 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 473 | MG890367 | Pectobacterium carotovorum strain 8695 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2494.18 | 0.00e+00 | 98.9% |
| 474 | MG890353 | Pectobacterium carotovorum strain 3OG 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2492.2 | 0.00e+00 | 98.9% |
| 475 | FJ593028 | Pectobacterium carotovorum subsp. carotovorum strain 301933 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2492.2 | 0.00e+00 | 98.9% |
| 476 | CP066552 | Pectobacterium carotovorum strain 2A chromosome, complete genome | 1312 | 100.0% | 17419.62 | 0.00e+00 | 98.8% |
| 477 | CP065030 | Pectobacterium versatile strain F131 chromosome, complete genome | 1312 | 100.0% | 17401.78 | 0.00e+00 | 98.8% |
| 478 | CP102749 | Pectobacterium parvum strain YT22221 chromosome, complete genome | 1312 | 100.0% | 17405.75 | 0.00e+00 | 98.8% |
| 479 | MN394108 | Pectobacterium carotovorum subsp. odoriferum strain PZ6 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2488.23 | 0.00e+00 | 98.8% |
| 480 | MN393902 | Candidatus Pectobacterium maceratum strain PJ6 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2488.23 | 0.00e+00 | 98.8% |
| 481 | MN394019 | Pectobacterium carotovorum subsp. carotovorum strain PJ19 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2488.23 | 0.00e+00 | 98.8% |
| 482 | MN394017 | Pectobacterium carotovorum subsp. carotovorum strain PJ5 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 483 | MW386652 | Pectobacterium carotovorum subsp. carotovorum strain FHD003 16S ribosomal RNA gene, partial sequence. | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 484 | OP941556 | Pectobacterium polaris strain ZRIMU1223 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 485 | MG890364 | Pectobacterium carotovorum strain 8692 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 486 | OP941523 | Pectobacterium polaris strain DL18130 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 487 | OR471426 | Pectobacterium polaris strain S6 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 488 | OP941527 | Pectobacterium polaris strain ZRIMU1024 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 489 | OP941557 | Pectobacterium polaris strain ZRIMU1224 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 490 | MH166801 | Pectobacterium sp. strain IFB5223 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 491 | CP017482 | Pectobacterium polaris strain NIBIO1392 chromosome, complete genome | 1312 | 100.0% | 17403.75 | 0.00e+00 | 98.8% |
| 492 | NR_159084 | Pectobacterium polaris strain NIBIO1006 16S ribosomal RNA, complete sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 493 | OP941555 | Pectobacterium polaris strain ZRIMU1222 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 494 | CP077421 | Pectobacterium polaris strain QK413-1 chromosome, complete genome | 1312 | 100.0% | 17403.75 | 0.00e+00 | 98.8% |
| 495 | OL702857 | Pectobacterium sp. strain Doshtor 2 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 496 | OP941528 | Pectobacterium polaris strain ZRIMU1022 16S ribosomal RNA gene, partial sequence | 1312 | 100.0% | 2486.25 | 0.00e+00 | 98.8% |
| 497 | CP051652 | Pectobacterium carotovorum strain WPP14 chromosome, complete genome | 1312 | 100.0% | 17344.29 | 0.00e+00 | 98.7% |
| 498 | CP017481 | Pectobacterium polaris strain NIBIO1006 chromosome, complete genome | 1312 | 100.0% | 17340.32 | 0.00e+00 | 98.7% |
| 499 | CP087392 | Pectobacterium parvum strain FN20211 chromosome, complete genome | 1312 | 100.0% | 17282.84 | 0.00e+00 | 98.6% |
| 500 | CP088019 | Pectobacterium carotovorum strain 25.1 chromosome, complete genome | 1312 | 100.0% | 17229.29 | 0.00e+00 | 98.5% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the distribution of BLAST hits identity within each genus. Each data point shows the alignment identity between the query sequence and reference sequence. The analyst may wish to refer to this figure when making a subjective genus-level identification for the sample.
Analyst evaluation
Taxa of interest (TOI)
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
Reference sequence source diversity
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Analyst evaluation
No candidate species to report on.
Intraspecies diversity
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
Analyst evaluation
Taxonomy Check
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |